Represent Objects in Numerals 1 to 20

Name Grade School
Date Questions10 Score

1
bugbugbugbug
2
catcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcat
3
tophattophattophattophattophattophattophattophattophattophat
4
tomatotomatotomato
5
hatched_chickhatched_chickhatched_chickhatched_chickhatched_chickhatched_chickhatched_chickhatched_chickhatched_chick
6
tennistennistennistennistennistennistennistennis
7
lemonlemonlemonlemonlemonlemonlemonlemonlemonlemonlemonlemonlemonlemon
8
corncorncorncorncorncorncorncorncorncorncorncorncorncorncorncorncorn
9
grapesgrapesgrapesgrapesgrapesgrapesgrapesgrapesgrapesgrapesgrapes
10
birdbirdbirdbirdbirdbirdbird

Answers Key
1
bugbugbugbug
4
2
catcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcatcat
20
3
tophattophattophattophattophattophattophattophattophattophat
10
4
tomatotomatotomato
3
5
hatched_chickhatched_chickhatched_chickhatched_chickhatched_chickhatched_chickhatched_chickhatched_chickhatched_chick
9
6
tennistennistennistennistennistennistennistennis
8
7
lemonlemonlemonlemonlemonlemonlemonlemonlemonlemonlemonlemonlemonlemon
14
8
corncorncorncorncorncorncorncorncorncorncorncorncorncorncorncorncorn
17
9
grapesgrapesgrapesgrapesgrapesgrapesgrapesgrapesgrapesgrapesgrapes
11
10
birdbirdbirdbirdbirdbirdbird
7

Represent Objects in Numerals from 0 to 20 Worksheet

The CCSS.MATH.K.CC.A.3 worksheets for kindergarten students to practice writing the numbers from 0 to 20 and represent a number of objects with a written numeral 0-20 is available online for free in printable and downloadable (pdf & image) format. For more questions and answers on K.CC.A.3 math activities, tap on generate new worksheet to learn, practice, test and verify math skills under the common core cluster (KCCA) know number names and the counting sequence in domain counting and cardinality.

How to Use this Worksheet

To practice these math problems of K.CC.A.3 worksheets, students are required to find the answer by counting how many number of objects present in the box and write the corresponding NUMERAL for it. The number of objects for each questions be not more than 20. The main objective of these K.CC.A.3 activities is to make students to know number names and the counting sequence. Users can directly refer the answer key to verify the work with steps for corresponding practice problems given in the K.CC.A.3 activities for common core state standards for mathematics.

Loading...

Loading...
Loading...
Loading...
kuku
Hey! I'm kuku
I can answer you simple math queries!
Question KuKu's Answer